Advertisement
Journal Home
Search for

Volume 45, Issue 1, Pages 45-52 (January 2003)


View previous. 9 of 12 View next.

Igm recognition of recombinant Toxoplasma gondii antigens by sera of acutely or latently infected humans

Bob Meeka, Robert Jan Dieperslootb, Tom van Goolc, Dave Speijerd, Ron PeekaCorresponding Author Informationemail address

Received 29 April 2002; accepted 19 August 2002.

Abstract 

Clinical non-relevant (CNR) IgM specific for Toxoplasma gondii is responsible for false-positive results in commercially available IgM assays. Using IgM immunoblotting, it is possible to distinguish between IgM in sera of acutely infected (AI) patients and CNR IgM. Especially the combination of staining of a 55 and 30 kD antigen in T.gondii lysate proved useful in this respect. The 55 kD antigen was identified as Rop1, while the 30 kD antigen was confirmed to be Sag1. However, the use of recombinant antigens instead of lysates for diagnostic assays would improve reproducibility. IgM recognized recombinant Rop1, but most CNR sera also had low anti-Rop1 titers. Although purified native Sag1 separated AI and CNR sera very well on immunoblot, IgM did not recognize recombinant Sag1 at all. Clearly, it is difficult to produce a recombinant Sag1 that can be recognized by IgM. Recombinant Rop1 might be suitable as one of the recombinant antigens in an IgM immunoblot assay, but has to be combined with at least one other immunogenic antigen.

Article Outline

Abstract

1. Introduction

2. Materials and methods

2.1. Sera

2.2. Antigen preparation

2.3. Primers and cloning of PCR products

2.4. SDS-PAGE and Western blotting

2.5. Immunostaining of peroxidase conjugated antibodies

2.6. Preincubation with intact parasites

2.7. Immunofluorescence (IF)

2.8. Elution of IGM antibodies

3. Results

3.1. The 55 kD antigen is Rop1

3.2. Potentially confounding factors

3.3. Recognition of a panel of recombinant TG antigens by IGM

4. Discussion

References

Copyright

1. Introduction 

return to Article Outline

Toxoplasma gondii (Tg) is a ubiquitous protozoan parasite that infects many individuals world-wide. Although the symptoms of infection are usually benign, especially Tg infection during pregnancy can cause life-threatening complications to the fetus. Tg serology is essential to determine whether a pregnant woman is experiencing seroconversion. Detection of anti-Tg IgM is one of the hallmarks of seroconversion (Beaman et al., 1995). However, one of the problems of Tg serology is the existence of clinically non-relevant (CNR) Tg specific IgM antibodies that persist in sera of individuals who have been infected many years ago Gorgievski-Hrisoho et al 1996, Del Bono et al 1989, Bobic et al 1991, Meek et al 2001. Our previous experiments demonstrated that many commercially available IgM tests give positive results with well-defined sera containing CNR IgM antibodies (Meek et al., 2001). In combination with low IgG titers, sera with CNR IgM are easily confused with those from acutely infected (AI) individuals, and have caused unwarranted concerns and terminations of pregnancy (Liesenfeld et al., 1997). It has also been demonstrated that CNR IgM antibodies recognize the same antigens as those frequently recognized by IgM in sera of AI individuals Meek et al 2001, Verhofstede et al 1990, making it very difficult to devise a toxoplasma antibody test based on specific antigens that will distinguish CNR from AI sera.

Interestingly, using standard immunoblotting (IB) of non-reduced Tg antigens it is possible to distinguish CNR from AI sera based on differences in intensity of recognition of a 30 kD antigen, most likely Sag1. In addition, a combination of intense recognition of the 30 kD antigen and one other antigen, either a GPI anchor or an unidentified 55 kD antigen, proved very useful in the distinction between CNR and AI sera (Meek et al., 2001).

Sag1 is one of the first antigens recognized by IgM during acute infection, along with the GPI anchor Sharma et al 1983, Erlich et al 1983. Detection of Sag1 specific IgM is regarded as clinically relevant, and an anti-Sag1 IgM specific ELISA is available (Cesbron et al., 1985). Although our previous results indicated that CNR IgM antibodies recognize Sag1 as well, IgM IB is clearly not as sensitive to anti-Sag1 CNR IgM as commercially available assays. Therefore, IgM IB should be used as a confirmation assay in cases of doubt. However, the use of an incompletely defined Tg lysate as antigen source may cause reproducibility problems in anti-Tg IgM staining patterns due to batch differences, while maintenance of Tg parasites is laborious and expensive. To establish IgM IB as a confirmation assay, it is important to use a standard set of well-defined recombinantly produced antigens.

The objective of this study was to test whether a selected set of immunoblotted recombinant antigens would result in an easy and reproducible confirmation assay for the serology of toxoplasmosis. Identification and cloning of the Tg 55 kD antigen may result in a very useful candidate for an IgM IB assay. In addition, recent expression techniques has allowed the production of purified, recombinant Sag1 recognized by IgG antibodies in human sera (Biemans et al., 1998), indicating that recombinant Sag1 protein has adopted a conformation required for recognition by antibodies. This preparation of recombinant Sag1 together with a recombinant version of the 55 kD antigen and IgM IB may allow the important distinction between sera containing CNR or AI IgM. Before exploring this, it is important to exclude that in some cases other Tg antigens with an approximate molecular weight (MW) of 30 kD are also involved in the anti-Tg IgM response. Moreover, it is not known whether IgM specific for free GPI anchor is also able to recognize GPI-anchored Sag1. Therefore, it is critical to determine if recognition of the 30 kD antigen on immunoblot is solely due to Sag1.

2. Materials and methods 

return to Article Outline

2.1. Sera 

All sera used in this study were submitted for routine toxoplasmosis screening (Meek et al., 2001). Sera were stored at 20°C. AI sera were from cases with acute toxoplasmosis (AI), characterized by an IgG titer ≥250 IU/ml in the SF dye test and/or a three fold increase of the SF dye test titer in the follow up sample taken 3-4 weeks later, and positive results in the Abbott IMx IgM and ISAGA IgM assays. CNR sera were obtained from persons who were latently infected with Toxoplasma as characterized by a low and stable SF titer between 6 and 63 IU/ml in two serum samples taken three weeks apart and a clinically non-relevant (CNR) IgM titer in the IMx IgM assay. The term ‘clinically non-relevant’ indicates that anti-parasitic treatment of these patients would be wrong, and that possible clinical signs of infection (‘flue-like’ disease) must stem from a different cause.

Sera of patients suffering from AIDS or sera of immuno-compromised patients were excluded.

2.2. Antigen preparation 

Antigen preparation was performed as described elsewhere (Meek et al., 2000). The protein concentration of the supernatant (lysate/sonicate) was measured using the Bradford assay with BSA as a standard. The sonicate was frozen in small aliquots containing 200 μg protein (equal to 7.7 × 106 tachyzoites) and kept at –70°C until use.

2.3. Primers and cloning of PCR products 

Primers used for amplification of open reading frames encoding Rop1 by PCR and Gra2 by RT-PCR: Rop-FW 5′GAGACCATGGTACTTTCGAGCCACAATGGA3′, Rop -RV 5′GAGAGAATTCTTGCGATCCATCATCCT3′, Gra -FW 5′GAGAGGATCCCCATGTTCGCCGTAAAACATG3′ and Gra-RV 5′GAGAGGTACCTTACTGCGAAAAGTCTGGGA3′. PCR products were ligated into an appropriately digested expression vector pRP261, a derivative of vector pGEX-3X (Amersham-Pharmacia, Uppsala, Sweden).

Immunoaffinity purification of native Sag1 and production of recombinant Sag1 Native Sag1 was immunoaffinity purified as described earlier (Velge-Roussel et al., 1994). Recombinant Sag1 produced in Pichia pastoris was kindly provided by Alain Jacquet (Biemans et al., 1998).

Expression and purification of recombinant GST-Rop1, GST-Gra2 and GST. All proteins were expressed in E.coli strain BL21. Before expression induction, BL21 were grown until OD600: 0.8-1 at 37°C. Expression was induced by isopropyl-β-D-thiogalactopyranoside (1 mM) for 2 h at 30°C. Upon centrifugation at 3500g for 10 min, cells were resuspended in PBS (pH 7.4) with protease inhibitors (Complete; Roche Diagnostics, Mannheim, Germany), 1 mM EDTA, 1 mM dithiotreitol and 1% (v/v) Triton X-100. Next, the suspension was freeze/thawed three times and sonicated eight times for 15 sec (Soniprep 150; MSE, Loughborough, UK) on ice. Insoluble components were removed by centrifugation (16000g, 10 min, 4°C), and subsequent filtration (0.45 μm). GST fusion proteins were purified and eluted from the supernatant using Glutathione Sepharose 4B beads according to the manufacturer’s instructions (Amersham-Pharmacia). The amount of each recombinant protein used for immunoblots was normalized based on intensity of Coomassie staining on gel and staining with anti-GST antibody (Sigma, St. Louis, MO) on immunoblot (see below).

2.4. SDS-PAGE and Western blotting 

SDS-PAGE was performed as described (Schagger & von Jagow, 1987). 200 μg of the sonicate or 10 μg of purified protein was suspended in SDS-PAGE sample buffer (without reducing agent) to a final volume of 200 μL, boiled for 2 min, and loaded onto 10% SDS-PAGE gels. A broad range marker (Bio-Rad Laboratories, Hercules, CA) was included. After electrophoresis, proteins were transferred to polyvinyldifluoride (PVDF) membranes (Millipore, Bedford, Ma) overnight. Transferred proteins and markers were visualized using Ponceau-red dye staining.

Blocking buffer consisted of Tris-buffered saline (TBS: 50 mM TrisHCl, 150 mM NaCl, pH 10) containing 0.5% Tween20 and 2% non-fat milk powder.

2.5. Immunostaining of peroxidase conjugated antibodies 

Except when stated otherwise, all samples and conjugates were diluted in TBS containing 0.5% Tween20 and 0.03% non-fat milk powder (TBS-T). All incubations were done using a multiscreen apparatus (Mini-Protean II; Bio-Rad Laboratories, Hercules, CA). Isotype specific antibodies conjugated to peroxidase were obtained from DAKO (DAKO, Glostrup, Denmark). The conjugates were diluted 1:5000. All incubations were performed at room-temperature for 75 min.

The serum samples of the patients were diluted 50x (unless stated otherwise), incubated, and tested for the presence of anti-T.gondii IgM. A mouse monoclonal antibody against SAG1 (HyTest, Turku, Finland) was diluted 1000x, monoclonal Tg49 specific for Rop1 (kindly provided by Dominique Soldati, Heidelberg) was diluted 500x, Gra2 specific monoclonal (gift from Marie-France Cesbron-Delauw, Grenoble) was diluted 10000x. Chemiluminescent substrate was prepared according to the manufacturers descriptions (ECL; Amersham Pharmacia Biotech, Essex, UK). The membranes were incubated with chemiluminescent substrate for 1 min, and exposed to X-ray film for various time-intervals.

2.6. Preincubation with intact parasites 

Parasites were purified as described above, resuspended in TBS, and counted. Serum samples were heated for 30 min at 56°C to inactivate complement, diluted in TBS, mixed with 50 μL PBS containing 2 × 107 purified parasites and incubated for 30 min under gentle rotation. Parasites were pelleted (800× g, 5 min) after incubation and supernatants were split: half was immediately incubated with blots (fraction 1), the rest was incubated once more for 30 min with fresh parasites. After centrifugation, this double absorbed supernatant was incubated with the blots as well (fraction 2). As negative control, samples were treated similarly, but mixed with buffer without parasites (c). Before fractions were incubated with blots, Tween-20 and milk powder were added to final concentrations of 0.5% and 0,03%, respectively. Bound antibodies were detected by chemiluminescence.

Preincubations with purified recombinant Gra2, Rop1 and GST were essentially performed as described for intact parasites; 2 μg recombinant protein was used for each incubation.

2.7. Immunofluorescence (IF) 

IF was performed as described (Manger et al., 1998), except parasites were not fixated. In short, 105 filter-purified, freshly egressed parasites were incubated with mouse monoclonal antibodies against SAG1 (HyTest, Turku, Finland) and Rop1 (Tg49), diluted 500× and 250x, respectively, in PBS containing 2% BSA, at 4°C for 30 min. Following 4 washes, parasites were incubated with an anti-mouse Fab conjugated to indocarbocyanine (Cy3) (Jackson ImmunoResearch Laboratories, West Grove, PA), diluted 750x, for 30 min. Following washing and drying, labeled parasites were embedded in Vectashield (Vector Laboratories, Burlingame, CA) and visualized using a fluorescence microscope (Leica DMRE/RD, Leica, Wetzlar, Germany) equipped with a camera. Alternatively, parasites were dried on slides and fixated with either aceton (−20°C) or 3% paraformaldehyde, 0.05% glutaraldehyde at room-temperature as described Leriche and Dubremetz 1991, Ortega-Barria and Boothroyd 1999. Fixated parasites were exposed to the same monoclonals.

2.8. Elution of IGM antibodies 

Fragments of lysate blots containing either GPI anchor or antigens with MWs ranging between 28-32 kD were incubated with sera containing IgM antibodies specific for GPI anchor and Sag1. Following washings, IgM were eluted by incubation for 10 min with a solution containing 50 mM glycine (pH 2.8), 0.5% Tween20, and 1% BSA. Mock elution was done with PBS. Samples were neutralized by adding TBS to a final concentration of 50 mM TrisHCl, 150 mM NaCl (pH 10), 0.5% Tween20 and 0.3% non-fat milk powder. Subsequently, samples were reincubated with fresh lysate blots.

3. Results 

return to Article Outline

3.1. The 55 kD antigen is Rop1 

IgM antibodies are usually directed against surface antigens, therefore preabsorption using intact parasites was performed to determine if the 55 kD antigen recognized predominantly by AI sera, has surface-exposed epitopes. As shown in Fig. 1 preabsorption indeed resulted in disappearance of the 55 kD band, demonstrating that this antigen is present on the surface of tachyzoites. A monoclonal specific for Rop1 also stained an antigen at 55 kD, so, being a candidate-antigen, Rop1 was cloned and expressed as glutathione-S-transferase (GST)-fusion protein in E.coli. In addition to full length GST-Rop1 (∼85 kD), expression and purification resulted in various smaller truncated forms in the range of 70-83 kD (not shown). Clearly, GST-Rop1 is highly susceptible to proteolytic degradation, as described earlier, possibly due to its unusual charge distribution Leriche and Dubremetz 1991, Ossorio et al 1992. Sera from acutely and latently infected individuals known to contain anti-55 kD IgM were incubated successively with 2 μg of the purified recombinant Rop1. In each case, this resulted in a specific and gradual decrease of staining of the 55 kD antigen from the anti-toxoplasma IgM staining patterns (Fig. 2), identifying these frequently found IgM antibodies in sera of acutely infected individuals as anti-Rop1 antibodies.


View full-size image.

Fig. 1. The 55 kD antigen:SAG1/P30, and the GPI anchor are surface exposed antigens. Heat inactivated sera of AI 1 and CNR 5 were diluted as indicated, and mixed with a serum that contained IgM antibodies recognizing a 45kDa Tg antigen (diluted 1/1000). The diluted sera were mixed sequentially (lanes labeled ‘1st’ and ‘2nd’, see Method section) with either 2 × 107 parasites in PBS or PBS only. Control lanes represent IgM staining patterns after two incubations with PBS only.



View full-size image.

Fig. 2. The 55 kD antigen is Rop1. Diluted, as indicated, sera of AI 8, AI 5 and CNR 9 were successively incubated with either 2 μg recombinant Rop1 (lanes 2 and 3), PBS (lane 1) or GST (lane 4). Of the latter incubations, only IgM staining patterns after repated incubation are shown. Monoclonal Tg49, specific for Rop, was used to indicate its position.


Rop1 is not specifically described as a surface-antigen (Schwartzman, 1986). However, immunofluorescence experiments using the monoclonal specific for Rop1 on intact parasites indeed showed a homogeneous surface staining of approximately 5% of the parasites (Fig. 3A-B-C). Once fixated, all parasites demonstrated the expected apical staining pattern following incubation with the anti-Rop1 monoclonal (Fig. 3D-E-F; (Schwartzman, 1986)). Homogeneous staining of fixated parasites was not observed when fixated.


View full-size image.

Fig. 3. A monoclonal specific for Rop1 stains the surface of a minority of parasites. Intact (A-C) and fixated (D-F) parasites were incubated with anti-Rop, and analyzed with immunofluorescence. Panel B is a brightfield image of parasites in panel A. Panel C is an overlay of A and B. Panel E shows the nuclear staining of the parasites in panel D by Hoechst 33258. Panel F is an overlay of D and E, demonstrating apical Rop1 staining of fixated parasites, which was observed irrespective of fixation procedure and treatment with 0.2% Triton X100. Bar = 2 μm.


3.2. Potentially confounding factors 

Sag1 and the GPI anchor are known to be major targets of the AI and CNR anti-toxoplasma IgM antibodies in humans. As Sag1 is a GPI-anchored membrane protein we wondered whether IgM antibodies specific for the GPI anchor contribute to the intense signal at 30 kD. By elution of IgM antibodies recognizing either GPI anchor or Sag1 from blots, and subsequent testing of these eluates on a lysate blot, it was demonstrated that these antibodies only recognized the antigen they were initially eluted from (Fig. 4).


View full-size image.

Fig. 4. IgM antibodies recognizing GPI anchor do not crossreact with Sag1. IgM antibodies in serum of AI 5 strongly recognize GPI anchor and Sag1 (lane A). Serum diluted 200x, incubated with either a toxoplasma lysate blot containing antigens ranging in MW from 28 to 38 kD (a.o. Sag1, B) or a blot containing antigens of up to 6 kD (GPI anchor, C) was tested upon elution, using the conditions indicated (see M & M) and neutralized. Samples were applied to a whole lysate blot and stained for IgM antibodies (lanes B’; Sag1 and C’; GPI anchor, respectively).


The 30 kD signal may not only result from Sag1 recognition, as the Gra2 specific monoclonal stained an antigen at 30 kD as well, although Gra2 is supposed to run at approximately 28 kD. The monoclonal proved to be Gra2 specific as recognition was efficiently abrogated following preabsorption with purified, recombinant GST-Gra2 (Fig. 5).


View full-size image.

Fig. 5. Gra2 and Sag1 comigrate. The specificity of Gra2 staining was investigated by sequential incubation of both monoclonals with recombinant GST-Gra2. Monoclonal specific staining on a toxoplasma lysate blot following preabsorption is shown: anti-Gra2: lanes 2 and 3, anti-Sag1: lane 3 (only shown after two rounds of preabsorption). Controls are sequential incubations with GST (lanes 4) or with PBS (lanes 1).


3.3. Recognition of a panel of recombinant TG antigens by IGM 

Based on earlier results (Meek et al., 2001) and the experiments described above, a number of antigens were selected for testing with a panel of extensively characterized sera from AI and CNR individuals on immunoblot. First, it was of interest to determine with this panel of sera if recombinant Rop1 recognition could distinguish between AI and CNR sera. Secondly, we wanted to dissect the IgM signal at 30 kD that allowed distinction between AI and CNR individuals on Tg lysate IB. Thus this panel of sera was tested on blots containing purified-native Sag1, recombinant Rop1, recombinant GST-Gra2 (Fig. 6), recombinant Sag1 or GST alone (not shown).


View full-size image.

Fig. 6. Comparison of purified antigen and T.gondii lysate recognition by AI and CNR IgM. Diluted sera were applied to blots containing purified recombinant (GST-Rop1and GST-Gra2) and native (nSag1) Toxoplasma proteins or total lysates (T.gondii lysate). Besides full-length protein(∼83 kD), expression of Rop1 resulted in various truncated versions of Rop1, ranging mainly between 70 and 83 kD, hence the ladder of IgM bands in the rRop1 lanes.


Recognition of recombinant Rop1 by AI and CNR IgM coincided with recognition of the 55 kD antigen on a toxoplasma lysate immunoblot using shorter exposures (≤10 min, Fig. 6, compare upper and middle panel). Longer exposures (≥60 min) revealed that many samples showed an anti-Rop1 staining IgM pattern that coincided with recognition of the 55 kD antigen, except for samples CNR 7 and CNR 12 (Figure 6, compare second panel above and middle panel).

Most of the AI sera with an intense signal at 30 kD also intensely recognized native Sag1, while none of the sera displayed strong recognition of recombinant Gra2 (Figure 6, compare lower three panels). Three sera showed a weaker anti-Sag1 (AI 4, AI 10 and CNR 7) signal than expected, which may be due to recognition of a third antigen at approximately 30 kD, while one sample had an overall weak response to the purified proteins (AI 5). In contrast, CNR sera never intensely recognized native Sag1. Except for 1 sample (CNR10, Fig. 6), recognition of native Sag1 by CNR IgM was as could be expected on the basis of IgM patterns on lysate immunoblot. CNR IgM never bound recombinant Gra2. None of the sera displayed reactivity on immunoblot against GST, or recombinant Sag1 (results not shown).

4. Discussion 

return to Article Outline

In this study we tested whether a selected set of immunoblotted recombinant antigens would result in an easy and reproducible confirmation assay for toxoplasmosis serology. Immunoblotting is one of the few available methods allowing a clear distinction between CNR and AI IgM. The 55 kD antigen preferentially recognized by IgM in AI sera (Meek et al., 2001), has now been identified as Rop1. This protein belongs to a group of antigens discharged from the rhoptries during Tg invasion and is involved in the formation of the parasitophorous vacuole (Carruthers & Sibley, 1997). Samples from both groups with a clear signal at 55 kD on Tg lysate immunoblot indeed recognized recombinant Rop1. On longer exposure many other serum samples displayed reactivity against rec Rop1, especially in the CNR IgM group, despite the absence of a signal at 55 kD in the IgM staining patterns analyzed. These anti-Rop1 antibodies might have been missed in our earlier analysis (Meek et al., 2001), as the exposures used were too short to allow detection of low titers of anti-Rop1 IgM.

Surprisingly, IgM antibodies specific for Rop1 were preabsorbed using intact parasites, while Rop1 is not known to be a surface antigen. Our finding was supported by surface staining of a minority of the intact parasites by the Rop1 monoclonal. Experiments with fixated parasites demonstrated exclusive anti-Rop1 staining of the anterior part of the parasite as described earlier Schwartzman 1986, Saffer et al 1992. Studies that describe localization and function of Rop1 during infection generally have used fixated cells, which might explain how surface staining was missed previously. The function of Rop1 at the parasites surface remains enigmatic.

Rop1 (P66) is a known target of IgM antibodies during acute infection, and has been selected for an anti-Tg IgM ELISA based on recombinant antigens (Aubert et al., 2000). Our results indicate that Rop1 as single antigen is not suitable for diagnostic assays, as anti-Rop1 antibodies may cause persistent backgrounds due to intense recognition by CNR IgM. In combination with other recombinant antigens, however, Rop1 may still be valuable in an IgM IB assay as CNR IgM generally recognizes only 1 antigen intensely.

As expected, the signal at 30 kD observed in previous experiments can, in most cases, be attributed to anti-Sag1 IgM. Surprisingly, Gra2 turned out to be a potential confounding antigen, despite its predicted lower molecular weight. The observation that Gra2 and Sag1 comigrate might be a peculiarity of the tricine gels. Although anti-Gra2 antibodies constitute part of the anti-Tg IgG repertoire and recombinant Gra2 is very well recognized by IgG (Klaren & Peek, 2001), recombinant Gra2 was hardly recognized by IgM and could thus be excluded as potential confounder. This confirms earlier findings that Gra2 is not a major target of anti-Tg IgM antibodies (Aubert et al., 2000).

Another potential contribution to the signal at 30 kD could stem from anti-GPI anchor IgM. In a Tg lysate, Sag1 is known to be GPI anchored Nagel and Boothroyd 1989, Tomavo et al 1989. Two glycoforms of the Tg GPI anchor have been described of which type B contains the unique and immunogenic glycosylated N-acetylgalactosamine side chain (Zinecker et al., 2001). Using monoclonals, at least two epitopes have been identified on the GPI anchor that are sensitive to periodate and phospatidylinositol specific phospholipase C treatment Tomavo et al 1994, Sharma et al 1983. These GPI specific monoclonals do not stain membrane antigens on a lysate immunoblot (Tomavo et al., 1994), indicating that these epitopes are not available when the GPI anchor is coupled to a membrane antigen. This does not exclude that a polyclonal (human) anti-GPI response could generate cross-reactive antibodies. Nevertheless, our results indicate that also during a polyclonal response anti-GPI antibodies do not stain Sag1.

Following exclusion of confounding factors, we finally tested a recombinant version of Sag1 that is recognized by IgG antibodies in sera of latently infected individuals (Biemans et al., 1998). This indicates that at least part of the recombinant Sag1 is assembled in the proper conformation for IgG recognition. Unfortunately, IgM did not recognize this recombinant Sag1. Other attempts to incorporate recombinant Sag1 in IgM diagnostic assays have failed probably due to the complex structure of native Sag1 (Aubert et al., 2000). Importantly, recognition by IgM strongly relies on protein conformation, which is dependent on proper disulfide bridges (Velge-Roussel et al., 1994). The conformation of Sag1 results from a fine-tuned assembly interplay by several Tg chaperones and oxidoreductases. Although there is a report that mentions recognition by AI IgM of cloned Sag1 (Harning et al., 1996), it is difficult to express properly folded Sag1 in the large amounts required for standardized diagnostic assays.

IgM in two sera appeared to recognize another antigen at 30 kD next to Sag1. A possible candidate that we have not tested is the P35 antigen that runs also at approximately 31 kD under non-reduced conditions (Couvreur et al., 1988). Recombinant P35 performed well in an anti-Tg IgM ELISA Aubert et al 2000, Suzuki et al 2000 and could be an alternative to Sag1to be tested in an IgM IB assay. Potentially important for the next generation of anti-Tg IgM assays are attempts to produce the GPI anchor in vitro (Pekari et al., 2001). Our previous results argue against the use of the GPI anchor as a single antigen in an assay, but in combination with other cloned antigens it will certainly be of value.

Recombinant Rop1 might be suitable as one of the recombinant antigens in an IgM immunoblot assay, but has to be combined with at least one other, more immunogenic antigen like Sag1. Although immunoblotted native Sag1 can distinguish very well between AI and CNR sera, it clearly is difficult to make recombinant Sag1 recognizable by IgM. Promising alternatives are recombinant P35 and synthetic GPI anchor.

References 

return to Article Outline

Aubert et al 2000. 1. Aubert D, Maine GT, Villena I, Hunt JC, Howard L, Sheu M, et al. Recombinant antigens to detect Toxoplasma gondii-specific immunoglobulin G and immunoglobulin M in human sera by enzyme immunoassay. J Clin Microbiol. 2000;38:1144–1150. MEDLINE

Beaman et al 1995. 2. Beaman MH, McCabe RE, Wong SY, Remington JS. Toxoplasma gondii. In:  Mandell GL,  Bennett JE,  Dolin R editor. Mandell, Douglas and Bennett’s principles and practice of infectious diseases. New York: Churchill Livingstone Inc; 1995;p. 2455–2475.

Biemans et al 1998. 3. Biemans R, Gregoire D, Haumont M, Bosseloir A, Garcia L, Jacquet A, et al. The conformation of purified Toxoplasma gondii SAG1 antigen, secreted from engineered Pichia pastoris, is adequate for serorecognition and cell proliferation. J Biotechn. 1998;66:137–146.

Bobic et al 1991. 4. Bobic B, Sibalic D, Djurkovic-Djakovic O. High levels of IgM antibodies specific for Toxoplasma gondii in pregnancy 12 years after primary toxoplasma infection. Case report. Gynecol Obstet Invest. 1991;31:182–184. MEDLINE

Carruthers and Sibley 1997. 5. Carruthers VB, Sibley LD. Sequential protein secretion from three distinct organelles of Toxoplasma gondii accompanies invasion of human fibroblasts. Eur J Cell Biol. 1997;73:114–123. MEDLINE

Cesbron et al 1985. 6. Cesbron JY, Capron A, Ovlaque G, Santoro F. Use of a monoclonal antibody in a double-sandwich ELISA for detection of IgM antibodies to Toxoplasma gondii major surface protein (P30). J Immunol Methods. 1985;83:151–158. MEDLINE | CrossRef

Couvreur et al 1988. 7. Couvreur G, Sadak A, Fortier B, Dubremetz JF. Surface antigens of Toxoplasma gondii. Parasitology. 1988;97:1–10. CrossRef

Del Bono et al 1989. 8. Del Bono V, Canessa A, Bruzzi P, Fiorelli MA, Terragna A. Significance of specific immunoglobulin M in the chronological diagnosis of 38 cases of toxoplasmic lymphadenopathy. J Clin Microbiol. 1989;27:2133–2135. MEDLINE

Erlich et al 1983. 9. Erlich HA, Rodgers G, Vaillancourt P, Araujo FG, Remington JS. Identification of an antigen-specific immunoglobulin M antibody associated with acute Toxoplasma infection. Infect Immun. 1983;41:683–690. MEDLINE

Gorgievski-Hrisoho et al 1996. 10. Gorgievski-Hrisoho M, Germann D, Matter L. Diagnostic implications of kinetics of immunoglobulin M and A antibody responses to Toxoplasma gondii. J Clin Microbiol. 1996;34:1506–1511. MEDLINE

Harning et al 1996. 11. Harning D, Spenter J, Metsis A, Vuust J, Petersen E. Recombinant Toxoplasma gondii surface antigen 1 (P30) expressed in Escherichia coli is recognized by human toxoplasma-specific immunoglobulin M (IgM) and IgG antibodies. Clin Diagn Lab Immunol. 1996;3:355–357.

Klaren and Peek 2002. 12. Klaren VN, Peek R. Evidence for a compartmentalized B cell response as characterized by IgG epitope specificity in human ocular toxoplasmosis. J Immunol. 2001;167:6263–6269. MEDLINE

Leriche and Dubremetz 1991. 13. Leriche MA, Dubremetz JF. Characterization of the protein contents of rhoptries and dense granules of Toxoplasma gondii tachyzoites by subcellular fractionation and monoclonal antibodies. Mol Biochem Parasitol. 1991;45:249–259. MEDLINE | CrossRef

Liesenfeld et al 1997. 14. Liesenfeld O, Press C, Montoya JG, Gill R, Isaac-Renton JL, Hedman K, et al. False-positive results in immunoglobulin M (IgM) toxoplasma antibody tests and importance of confirmatory testing (the Platelia Toxo IgM test). J Clin Microbiol. 1997;35:174–178. MEDLINE

Manger et al 1998. 15. Manger ID, Hehl AB, Boothroyd JC. The surface of Toxoplasma tachyzoites is dominated by a family of glycosylphosphatidylinositol-anchored antigens related to SAG1. Infect Immun. 1998;66:2237–2244. MEDLINE

Meek et al 2000. 16. Meek B, Klaren VN, van Haeringen NJ, Kijlstra A, Peek R. IgA antibodies to Toxoplasma gondii in human tears. Invest Ophthalmol Vis Sc. 2000;41:2584–2590.

Meek et al 2001. 17. Meek B, van Gool T, Gilis H, Peek R. Dissecting the IgM antibody response during the acute and latent phase of toxoplasmosis. Diagn Microbiol Infect Dis. 2001;41:131–137. Abstract | Full Text | Full-Text PDF (160 KB) | CrossRef

Nagel and Boothroyd 1989. 18. Nagel SD, Boothroyd JC. The major surface antigen, P30, of Toxoplasma gondii is anchored by a glycolipid. J Biol Chem. 1989;264:5569–5574. MEDLINE

Ortega-Barria and Boothroyd 1999. 19. Ortega-Barria E, Boothroyd JC. A Toxoplasma lectin-like activity specific for sulfated polysaccharides is involved in host cell infection. J Biol Chem. 1999;274:1267–1276. MEDLINE | CrossRef

Ossorio et al 1992. 20. Ossorio PN, Schwartzman JD, Boothroyd JC. A Toxoplasma gondii rhoptry protein associated with host cell penetration has unusual charge asymmetry. Mol Biochem Parasitol. 1992;50:1–15. MEDLINE | CrossRef

Pekari et al 2001. 21. Pekari K, Tailler D, Weingart R, Schmidt RR. Synthesis of the fully phosphorylated GPI anchor pseudohexasaccharide of Toxoplasma gondii. J Org Chem. 2001;66:7432–7442. MEDLINE | CrossRef

Saffer et al 1992. 22. Saffer LD, Mercereau-Puijalon O, Dubremetz JF, Schwartzman JD. Localization of a Toxoplasma gondii rhoptry protein by immunoelectron microscopy during and after host cell penetration. J Protozool. 1992;39:526–530. MEDLINE

Schagger and von Jagow 1987. 23. Schagger H, von Jagow G. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem. 1987;166:368–379. MEDLINE | CrossRef

Schwartzman 1986. 24. Schwartzman JD. Inhibition of a penetration-enhancing factor of Toxoplasma gondii by monoclonal antibodies specific for rhoptries. Infect Immun. 1986;51:760–764. MEDLINE

Sharma et al 1983. 25. Sharma SD, Mullenax J, Araujo FG, Erlich HA, Remington JS. Western Blot analysis of the antigens of Toxoplasma gondii recognized by human IgM and IgG antibodies. J Immunol. 1983;131:977–983. MEDLINE

Suzuki et al 2000. 26. Suzuki Y, Ramirez R, Press C, Li S, Parmley S, Thulliez P, et al. Detection of immunoglobulin M antibodies to P35 antigen of Toxoplasma gondii for serodiagnosis of recently acquired infection in pregnant women. J Clin Microbiol. 2000;38:3967–3970. MEDLINE

Tomavo et al 1994. 27. Tomavo S, Couvreur G, Leriche MA, Sadak A, Achbarou A, Fortier B, et al. Immunolocalization and characterization of the low molecular weight antigen (4-5 kDa) of Toxoplasma gondii that elicits an early IgM response upon primary infection. Parasitology. 1994;108:139–145. CrossRef

Tomavo et al 1989. 28. Tomavo S, Schwarz RT, Dubremetz JF. Evidence for glycosyl-phosphatidylinositol anchoring of Toxoplasma gondii major surface antigens. Mol Cell Biol. 1989;9:4576–4580. MEDLINE

Velge-Roussel et al 1994. 29. Velge-Roussel F, Chardes T, Mevelec P, Brillard M, Hoebeke J, Bout D. Epitopic analysis of the Toxoplasma gondii major surface antigen SAG1. Mol Biochem Parasitol. 1994;66:31–38. MEDLINE | CrossRef

Verhofstede et al 1990. 30. Verhofstede C, Van Renterghem L, Plum J. Evaluation of immunoblotting for the detection of Toxoplasma gondii immunoglobulin M antibodies. Eur J Clin Microbiol Infect Dis. 1990;9:835–837. MEDLINE | CrossRef

Zinecker et al 2001. 31. Zinecker CF, Striepen B, Geyer H, Geyer R, Dubremetz JF, Schwarz RT. Two glycoforms are present in the GPI-membrane anchor of the surface antigen 1 (P30) of Toxoplasma gondii. Mol Biochem Parasitol. 2001;116:127–135. MEDLINE | CrossRef

a Department of Molecular Immunology, the Netherlands Ophthalmic Research Institute, Amsterdam, The Netherlands

b Laboratory for Medical Microbiology, Diakonessen Hospital, Utrecht, The Netherlands

c Department of Medical Microbiology, Section Parasitology, Academic Medical Center, Amsterdam, The Netherlands

d Department of Biochemistry, University of Amsterdam, Amsterdam, The Netherlands

Corresponding Author InformationCorresponding author. Tel.: +31-20-5666101; fax: +31-20-5666121.

PII: S0732-8893(02)00476-5

doi:10.1016/S0732-8893(02)00476-5


View previous. 9 of 12 View next.