Advertisement
Journal Home
Search for

Volume 45, Issue 1, Pages 81-84 (January 2003)

1 of 12 View next.

Real-time PCR for the rapid detection of vanA and vanB genes

Silvano PalladinoaCorresponding Author Informationemail address, Ian D. Kaya, Anna Maria Costaa, Erica J. Lamberta, James P. Flexmana

Received 10 May 2002; accepted 26 August 2002.

Abstract 

A real-time PCR assay suitable for use on the Roche LightCycler platform was developed to replace an existing gel-based PCR assay for the simultaneous detection of the vanA & vanB genes in enterococcal isolates. Novel Fluorescence Resonance Energy Transfer (FRET) hybridization probes were designed. The multiplex real-time PCR assay and the existing gel-based assay were 100% concordant and both correctly detected the vanA or vanB genes in 4/4 VanA E. faecium and 25/25 VanB E. faecium. Additionally, 1/1 VanC1 E. gallinarum, 1/1 VanC2 E. casseliflavus and 47/47 vancomycin susceptible enterococci were negative for the vanA and vanB genes in both PCR assays. Results were available within 1.5 h for the real-time PCR assay compared to up to 5.5 h for the conventional PCR assay.

Article Outline

Abstract

1. Introduction

Acknowledgment

References

Copyright

1. Introduction 

return to Article Outline

Enterococci are increasingly responsible for serious clinical and nosocomial infections including endocarditis, bacteraemia and urinary tract infections (Emori et al., 1993) and are recognized as the third most prevalent cause of nosocomial bacteraemias (Jones et al., 1997). The emergence and spread of glycopeptide resistance in enterococci has become a significant clinical concern and vancomycin-resistant enterococci (VRE) are now an increasingly important universal problem in hospitals worldwide.

Rapid and accurate identification of VRE is crucial in the management and treatment of both colonized and infected patients, to allow selection of appropriate antimicrobial treatment and to implement appropriate infection control procedures (HICPAC, 1995). Current phenotypic methods for the detection of glycopeptide resistance are limited in their ability to detect low-level glycopeptide resistance and to distinguish between the different Van types (Fluit et al., 2001). Molecular methods based on the PCR, for the detection of glycopeptide resistance were first described in 1995 (Dutka-Malen et al., 1995). PCR-based molecular methods have been demonstrated to be a feasible alternative to phenotypic methods for the detection of glycopeptide resistance Fluit et al 2001, Jayaratne and Rutherford 1999, Patel et al 1997, Pérez-Hernandez et al 20002. They are considered by some investigators to be superior as they overcome the limitations of phenotypic methods while reducing the time taken to obtain a result Chen et al 1998, Coombs et al 1999.

The advent of real-time PCR technology offers the potential for more rapid confirmation of VRE than is possible with either conventional PCR or phenotypic based methods. The LightCycler (Roche Molecular Biochemicals, Mannheim, Germany) is a commercially available instrument designed to rapidly perform both the PCR and the real-time fluorescence-based detection of the PCR product, in a closed system. In this report we describe the modification and evaluation of an existing PCR-based method for the simultaneous detection of the vanA & vanB genes into a real-time PCR assay suitable for use with the LightCycler system. The primers used in this real-time PCR assay have been shown to be highly specific for the detection of the vanA and vanB genes when used in a conventional PCR assay system (Dutka-Malen et al., 1995). However their performance in a real-time PCR format and in conjunction with the novel hybridization probes for each target described in this study, has not been previously reported.

Thirty one vancomycin resistant and 47 vancomycin susceptible isolates of enterococci, whose identification and vancomycin susceptibility had been determined using conventional methods, were tested in parallel by the real-time PCR and the conventional PCR assays. The control strains of enterococci used in both the conventional and real-time PCR assays were Enterococcus faecalis containing the vanB gene (ATCC 51299) and a clinical isolate of E. faecium containing the vanA gene (27637).

Identification and vancomycin susceptibility of each isolate were confirmed by Gram’s stain, colonial morphology, biochemical and growth characteristics and disk susceptibility testing using National Committee for Clinical Laboratory Standards methods (NCCLS, 2001). The MIC of isolates to vancomycin and teicoplanin were performed by Etest (AB Biodisk, Solna, Sweden). NCCLS guidelines, which include contamination control measures and the use of DNA negative samples as reaction controls in every run, were followed for all DNA manipulations for both the conventional and real-time PCR assays (NCCLS, 1995).

The conventional PCR using previously described VanA and VanB specific oligonucleotide primers (Free and Sahm, 1996) was multiplexed, allowing the amplification of both the vanA and vanB gene in the same tube. The amplification mix contained 1X reaction buffer (Roche Diagnostics, USA), 5 mM MgCl2, 2.25U Faststart Taq DNA polymerase (Roche Diagnostics, USA), 0.4μM each of VanA1, VanA2, VanB1 and VanB2 oligonucleotide primers (Life Technologies, Australia), 0.2μM of each deoxynucleotide (Pharmacia, Sweden) made up to a final volume of 99μL with water. A single colony of the organism was collected with a 1μL disposable loop and emulsified directly into the amplification mix. The following PCR program was performed on the PTC-100 Thermal Cycler (MJ Research); 95°C for 9 min initial activation step followed by, 94°C for 60 s, 56°C for 60 s, 72°C for 60 s for 30 cycles, and a final extension step of 72°C for 60 s. The 783 bp vanA and the 297 bp vanB fragments were detected using agarose gel electrophoresis and ethidium bromide visualization.

The real-time PCR assay used the same oligonucleotide primers as described by Dutka-Malen et al. (1995). The hybridization probes used for the real-time PCR assay were novel and were designed using the Roche Applied Science LightCycler Probe Design Software (Version 1.0). The suitability of the selected primer/probe combinations in the LightCycler format was assessed using the same software. A BLAST search of GenBank was performed on the oligonucleotide primers and hybridization probes to ensure specificity. The oligonucleotide sequences of the Van primers and probes are detailed in Table 1.

Table 1.

Oligonucleotide sequences (5′—3′) used in the real-time PCR

Primers
Probes
VanAFGGGAAAACGACAATTGC
VanARGTACAATGCGGCCGTTA
VanBFATGGGAAGCCGATAGTC
VanBRGATTTCGTTCCTCGACC
VanA-FLACGCAGTTATAACCGTTCCCG X
VanA-705LCRed705-AGACCTTTCAGCAGAGGAGCG p
VanB-FLCACGGTCAGGTTCGTCCT X
VanB-640LCRed640-TGGCGTAACCAAAGTAAACAGTACG p

p = phosphate, X = fluorescein

Enterococcal DNA was extracted and prepared by emulsifying one colony into 50μL of 10% Chelex 100 Resin Solution (Biorad, USA) made up in Tris Buffer (0.1 months, pH 7.5). This was incubated at 95°C for 10 min and then centrifuged at 16 060 g for 5 min in a microcentrifuge. The resultant supernatant was then used in the PCR reactions. The amplification mixtures were loaded into LightCycler glass capillaries (Roche Diagnostics, USA) containing 5μL of DNA extract, LightCycler Fast Start 10X Hybridization Probes Reaction Mix (Roche Diagnostics, USA), 2 mM MgCl2 solution, 1μM each of VanAF, VanAR, VanBF and VanBR oligonucleotide primers, 0.2μM VanA-FL, VanA-705, VanB-FL and VanB-640 oligonucleotide hybridization probes (TIB Molbiol, Germany) made up to a final volume of 20μL with water. The following PCR program was performed on the LightCycler; an initial activation/denaturation step at 95°C for 10 min, followed by amplification at 95°C with a 15 second hold, 50°C with a 15 second hold, 72°C with a 25 second hold for 40 cycles with a temperature transition rate of 20°C/s, and a final cooling step of 40°C for 60 s.

Real-Time PCR using the LightCycler was used to simultaneously analyze the vanA gene and vanB gene target sequences in each sample. Each product was analyzed using different fluorometer channels. The dye signal generated by the vanA product was measured at 710 ± 40 nm. The vanB product signal was measured at 640 ± 30 nm.

The real-time PCR assay and the existing gel-based assay were 100% concordant for the 78 enterococci tested. Both assays correctly detected the vanA or vanB genes in 4/4 VanA Enterococcus faecium and 25/25 VanB E. faecium. Additionally, 1/1 VanC1 E. gallinarum, 1/1 VanC2 E. casseliflavus and 47/47 vancomycin susceptible enterococci were negative for the vanA and vanB genes in both PCR assays.

The time taken to perform each assay was also evaluated. Results were available within 1.5 h for the real-time PCR assay compared to up to 5.5 h for the conventional PCR assay (Table 2). Although the real-time assay required less labor, it was more expensive with respect to reagent costs (Table 2). This was primarily due to the use of hybridization probes and a DNA extraction step, which were included in the real-time assay but not in the existing conventional PCR assay.

Table 2.

Comparison of conventional and real-time PCR assays

Conventional PCR
Real-time PCR
Total “hands-on” time*45 min30 min
Total “hands-on” labor cost*AUD16.00AUD10.65
Material Costs (Per Isolate)AUD4.00 (approx)AUD6.00 (approx)
Total Time to Result Once Isolate Obtained*(Including DNA extraction and result analysis)5 h 30 min1 h 30 min
*

Based on performing the assay on a batch of 30 isolates

The advent of real-time PCR represents a major advance in the developing role of molecular-based methods for the diagnosis of infectious diseases. Assays based on this technology offer the promise of rapid, sensitive and specific testing for the detection and identification of infectious agents. The PCR-based detection of the Van gene cluster has become the definitive test for the identification of vancomycin-resistance in enterococci. In this study we have successfully modified an existing multiplex PCR-based method for the simultaneous amplification of the Enterococcal vanA gene and the vanB gene, into a real-time multiplex PCR assay suitable for use with the LightCycler system.

The primers used in the real-time PCR assay described in this study have been shown to be highly specific for the detection of the VanA and VanB glycopeptide resistance genotypes when used in a conventional PCR assay system (Dutka-Malen et al., 1995). However the performance of these primers in a real-time PCR format and in conjunction with the novel hybridization probes for each target has not been previously reported. We found that the real-time PCR assay’s ability to detect the vanA and vanB genes was comparable to the existing PCR assay used in our laboratory. The two assays were 100% concordant. Although we were able to adequately evaluate the detection of the vanA or vanB genes in E. faecium, a limitation of this study is that we were unable to assess the assay’s detection of these genes in vancomycin resistant E. faecalis because of the low incidence of these organisms in our hospital.

The real-time PCR assay was developed to reduce the time taken to identify VanA & VanB VRE and formed part of the laboratory procedures implemented to control a large single-strain outbreak of VanB Enterococcus faecium (VREF) at Royal Perth Hospital between July and November 2001. The assay was successfully used during the outbreak and over one thousand isolates have now been tested in parallel with conventional phenotypic identification procedures with no discordant results (results not shown).

Once an isolate had been obtained, results were available within 1.5 h for the real-time PCR assay compared to up to 5.5 h for the conventional PCR assay (Table 2). This differential is diluted when added to the time required to culture and isolate an organism for PCR testing. However the real-time assay still provides a significant advantage over the conventional PCR, as results were available much earlier in the day which significantly assisted the infection control team with patient management. The time advantage would be even more significant if in the future, the assay can be successfully used directly on clinical specimens or even enrichment broths.

While the real-time assay was more expensive than the conventional PCR assay with respect to reagent costs significant savings in labor were realized (Table 2). The additional reagent costs were primarily due to the use of hybridization probes and a DNA extraction step, which were included in the real-time assay but not in the existing PCR assay. The cost per reaction of a set of LightCyler hybridization probes varies significantly depending on the batch size of probes ordered, from approximately AUD0.23 per reaction for a 30 nmol set to approximately AUD3.80 per reaction for a 300 pmol set. The costs quoted in this study refer to using the 30 nmol set, obviously the cost per reaction for the LightCycler PCR assay will be more if a smaller concentration probe set is used.

Finally, the use of sealed capillary tubes in the LightCycler format combined with the absence of post-amplification manipulation of the PCR product significantly reduces the risk of contamination due to amplicon carry-over. This is a significant advantage when performing large numbers of PCR reactions.

The ability of the LightCycler real-time PCR assay to provide rapid results with the demonstrated high sensitivity and specificity, suggests that the assay has the potential to realize significant advantages when used directly on clinical specimens or enrichment broths for the detection of VRE. However, further evaluation of the assay’s performance in these specimens is required, especially considering the high level of PCR inhibitors present in these samples.

Acknowledgements 

return to Article Outline

The expert assistance of the laboratory staff of the Department of Microbiology & Infectious Diseases, Royal Perth is gratefully acknowledged.

References 

return to Article Outline

Chen et al 1998. 1. Chen Y, Marshall SA, Winokur PL, Coffman SL, Wilke WW, Murray PR, et al. Use of molecular and reference susceptibility testing methods in a multicenter evaluation of microscan dried overnight gram-positive MIC panels for detection of vancomycin and high-level aminoglycoside resistances in enterococci. J Clin Microbiol. 1998;36:2996–3001. MEDLINE

Coombs et al 1999. 2. Coombs GW, Kay ID, Steven RA, Pearman JW, Bertolatti D, Grubb WB. Should genotypic testing be done on all phenotypically vancomycin-resistant enterococci detected in hospitals. J Clin Microbiol. 1999;37:1229–1230. MEDLINE

Dutka-Malen et al 1995. 3. Dutka-Malen S, Evers S, Courvalin P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J Clin Microbiol. 1995;33:24–27. MEDLINE

Emori and Gaynes 1993. 4. Emori TG, Gaynes RP. An overview of nosocomial infections, including the role of the microbiology laboratory. Clin Microbiol Rev. 1993;6:428–442. MEDLINE

Fluit et al 2001. 5. Fluit ADC, Maarten RV, Schmitz FJ. Molecular detection of antimicrobial resistance. Clin Microbiol Rev. 2001;14:836–871. MEDLINE | CrossRef

Free and Sahm 1996. 6. Free L, Sahm DF. PCR protocols for emerging infectious diseases. In: Washington, DC: ASM Press; 1996;p. 150–156.

Hospital Infection Control Practices Advisory Committee (HICPAC) 1995. 7. Hospital Infection Control Practices Advisory Committee (HICPAC). Recommendations for preventing the spread of vancomycin resistance. MMWR. 1995;44(RR-12):1–13.

Jayaratne and Rutherford 1999. 8. Jayaratne P, Rutherford C. Detection of clinically relevant genotypes of vancomycin-resistant enterococci in nosocomial surveillance specimens by PCR. J Clin Microbiol. 1999;37:2090–2092. MEDLINE

Jones et al 1997. 9. Jones RN, Marshall SA, Pfaller MA, Wilke WW, Hollis RJ, Erwin ME, et al. Nosocomial enterococcal blood stream infections in the SCOPE program (antimicrobial resistance, species occurrence, molecular testing results, and laboratory testing accuracy). Diagn Microbiol Infect Dis. 1997;29:95–102. Abstract | Full-Text PDF (851 KB) | CrossRef

National Committee for Clinical Laboratory Standards 1995. 10. National Committee for Clinical Laboratory Standards.. Molecular diagnostic methods for infectious diseases; approved guideline. MM3-A. Wayne, Pa: National Committee for Clinical Laboratory Standards; 1995;.

National Committee for Clinical Laboratory Standards 2001. 11. National Committee for Clinical Laboratory Standards.. Performance standards for antimicrobial disk susceptibility tests, 7th ed. Approved standard. M2-A7 & M100-S12. Wayne, Pa: National Committee for Clinical Laboratory Standards; 2001;.

Patel et al 1997. 12. Patel R, Uhl JR, Kohner P, Hopkins MK, Cockerill FR. Multiplex PCR detection of vanA, vanB, vanC-1, and vanC-2/3 genes in enterococci. J Clin Microbiol. 1997;35:703–707. MEDLINE

Pérez-Hernandez et al 20002. 13. Pérez-Hernandez X, Mendez-Alvarez S, Claverie-Martin F. A PCR assay for rapid detection of vancomycin-resistant enterococci. Diagn Microbiol Infect Dis. 2002;42(4):273–277. Abstract | Full Text | Full-Text PDF (137 KB) | CrossRef

a Department of Microbiology & Infectious Diseases, Royal Perth Hospital, Perth, Western Australia

Corresponding Author InformationCorresponding author. Tel.: +61 8 9224 2444; fax: +61 8 9224 1799.

PII: S0732-8893(02)00505-9

doi:10.1016/S0732-8893(02)00505-9

1 of 12 View next.